TB-Profiler result

Run: ERR4818690

Summary

Run ID: ERR4818690

Sample name:

Date: 01-04-2023 15:41:59

Number of reads: 1515452

Percentage reads mapped: 99.66

Strain: lineage4.9

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rpoA 3878158 c.329_349delTCGTGCCGCCGGCCGGCGTCA disruptive_inframe_deletion 0.11