TB-Profiler result

Run: ERR4821319
Summary

Run ID: ERR4821319

Sample name:

Date: 01-04-2023 17:11:08

Number of reads: 563613

Percentage reads mapped: 99.72

Strain: lineage4.9

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 7262 p.Val675Ile missense_variant 0.13
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7514 c.213C>T synonymous_variant 0.22
gyrA 8976 p.Phe559Leu missense_variant 0.12
ccsA 620434 p.Gly182Arg missense_variant 0.12
rpoB 761774 c.1968C>T synonymous_variant 0.22
rpoB 762442 p.Leu879Gln missense_variant 0.14
mmpL5 777294 p.Gly396Asp missense_variant 0.2
fbiC 1303753 p.His275Tyr missense_variant 0.11
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102072 p.Ala324Val missense_variant 0.11
katG 2154407 p.Pro569Thr missense_variant 0.18
kasA 2518368 p.Arg85Gln missense_variant 0.12
folC 2746145 c.1452_1453delTG frameshift_variant 0.22
folC 2746599 c.979_999delCGGGCCGGCTTTGCCGCCGTC conservative_inframe_deletion 0.5
folC 2746628 p.Asp324Val missense_variant 0.4
pepQ 2859547 p.Gly291Val missense_variant 0.17
Rv3236c 3613221 c.-105C>A upstream_gene_variant 0.14
fbiA 3640957 p.Gly139Ser missense_variant 0.13
alr 3840498 p.Ala308Glu missense_variant 0.17
alr 3840692 c.729C>A synonymous_variant 0.25
alr 3841389 p.Pro11Arg missense_variant 0.1
rpoA 3878550 c.-43C>A upstream_gene_variant 0.29
clpC1 4038798 p.Asn636Ser missense_variant 1.0
embA 4244130 p.Thr300Ser missense_variant 0.13
aftB 4267558 p.Ala427Ser missense_variant 0.29
aftB 4268527 p.Arg104Trp missense_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408048 c.154delT frameshift_variant 0.17