TB-Profiler result

Run: ERR4822081
Summary

Run ID: ERR4822081

Sample name:

Date: 01-04-2023 17:37:29

Number of reads: 1014468

Percentage reads mapped: 99.95

Strain: lineage4.9

Drug-resistance: HR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
katG 2155790 c.321delG frameshift_variant 0.11 isoniazid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
mshA 576459 c.1117_1147delGCGGTGGGCGGGCTGCCCGTCGCGGTGCGCG frameshift_variant 0.15
ccsA 620083 p.Ala65Ser missense_variant 0.11
ccsA 620748 c.858T>G synonymous_variant 0.26
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
thyX 3067514 p.Ser144Arg missense_variant 0.11
clpC1 4040241 p.Thr155Phe missense_variant 0.12
embC 4241663 p.Gly601Trp missense_variant 0.11