TB-Profiler result

Run: ERR4822144

Summary

Run ID: ERR4822144

Sample name:

Date: 01-04-2023 17:39:53

Number of reads: 2868051

Percentage reads mapped: 99.57

Strain: lineage4.1.1.3

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
lineage4.1.1.3 Euro-American (X-type) X1;X3 RD193 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 490658 c.-124_-71delGGAGCGAGCGCGAGCGCGGCAAGCCGGGTGCCGCGGGTCGCGACCATGGGATAT upstream_gene_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472004 n.159C>A non_coding_transcript_exon_variant 0.14
rrl 1474964 n.1307T>G non_coding_transcript_exon_variant 0.5
rrl 1476542 n.2885T>A non_coding_transcript_exon_variant 0.15
tlyA 1917972 c.33A>G synonymous_variant 0.98
katG 2156096 p.Pro6Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2859886 p.Ala178Val missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4249408 c.2895G>A synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0