TB-Profiler result

Run: ERR551847
Summary

Run ID: ERR551847

Sample name:

Date: 02-08-2023 08:34:16

Number of reads: NA

Percentage reads mapped: NA

Strain: lineage4.6.4

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.6 Euro-American T;LAM None 1.0
lineage4.6.4 Euro-American T;LAM None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gid 4408161 c.41delC frameshift_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576459 c.1117_1147delGCGGTGGGCGGGCTGCCCGTCGCGGTGCGCG frameshift_variant 0.11
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474750 n.1093C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2167693 p.Gly974Arg missense_variant 0.12
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3475139 p.Thr378Ile missense_variant 0.1
fbiB 3641915 c.381C>T synonymous_variant 0.17
rpoA 3878345 p.Arg55Ser missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244432 p.Ile400Met missense_variant 0.11
ethR 4328102 c.555_560delGTCATT disruptive_inframe_deletion 0.11
ethR 4328111 p.Ala188Gly missense_variant 0.11
ethR 4328113 c.565_566insAATGAC stop_gained&disruptive_inframe_insertion 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0