TB-Profiler result

Run: ERR7764380

Summary

Run ID: ERR7764380

Sample name:

Date: 02-04-2023 05:45:40

Number of reads: 3053177

Percentage reads mapped: 99.56

Strain: lineage4.1.1.3

Drug-resistance: Other


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
lineage4.1.1.3 Euro-American (X-type) X1;X3 RD193 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
pncA 2289036 p.Pro69Leu missense_variant 1.0 pyrazinamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576089 c.750_769delTGATCGGCGCGCGGCCCGGG frameshift_variant 0.23
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170048 p.Leu189Val missense_variant 0.13
PPE35 2170065 p.Ala183Gly missense_variant 0.35
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289017 c.225T>C synonymous_variant 1.0
pepQ 2860159 p.Ala87Gly missense_variant 0.19
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fbiD 3339734 p.Ala206Gly missense_variant 0.7
fbiD 3339746 p.Ala210Gly missense_variant 0.25
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4246527 p.Ala5Gly missense_variant 0.18
embB 4246544 p.Thr11Pro missense_variant 0.22
embB 4246584 p.Arg24Pro missense_variant 0.13
embB 4249408 c.2895G>A synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0