TB-Profiler result

Run: ERR9882583
Summary

Run ID: ERR9882583

Sample name:

Date: 02-04-2023 13:25:46

Number of reads: 738710

Percentage reads mapped: 97.24

Strain: lineage4.9

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
fgd1 491648 p.Asp289Gly missense_variant 0.12
rpoC 763647 p.Gly93Asp missense_variant 0.12
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474989 n.1332_1333insA non_coding_transcript_exon_variant 1.0
fabG1 1673380 c.-60C>G upstream_gene_variant 0.21
PPE35 2170048 p.Leu189Val missense_variant 0.15
PPE35 2170053 p.Thr187Ser missense_variant 0.11
pncA 2289735 c.-494C>G upstream_gene_variant 0.13
kasA 2519057 p.Thr315Ser missense_variant 0.13
kasA 2519062 c.948T>G synonymous_variant 0.12
kasA 2519065 c.951C>A synonymous_variant 0.12
kasA 2519066 c.956_982delACGCCGCGGAGGCCAACGCCATCCGCG disruptive_inframe_deletion 0.14
folC 2747361 p.Arg80Cys missense_variant 0.11
thyA 3074052 c.420G>T synonymous_variant 0.12
Rv3083 3449137 c.634C>A synonymous_variant 0.15
whiB7 3568875 c.-196C>T upstream_gene_variant 0.11
embC 4243082 c.3221_3228delATCTGAAC frameshift_variant 0.11
embC 4243092 p.Leu1077Arg missense_variant 0.11
embC 4243095 p.Gly1078Val missense_variant 0.11
embA 4243099 c.-134G>C upstream_gene_variant 0.11
embA 4243102 c.-131G>T upstream_gene_variant 0.11
embC 4243103 p.Thr1081Pro missense_variant 0.11
embC 4243106 p.Arg1082Ser missense_variant 0.11
embC 4243107 c.3245_3246insGTTCAGAT frameshift_variant 0.11
embA 4244185 p.Ser318Ile missense_variant 0.12
embB 4246578 p.Ser22Tyr missense_variant 0.12
embB 4246617 p.Leu35Pro missense_variant 0.11
embB 4248765 p.Asp751Gly missense_variant 0.1