TB-Profiler result

Run: SRR12142437

Summary

Run ID: SRR12142437

Sample name:

Date: 2024-03-26T12:13:39.779187

Number of reads: 11274183

Percentage reads mapped: 95.19

Median coverage: 576.0

Strain: lineage4.5

Spoligotype:

Drug-resistance: Other


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.5 Euro-American RD122 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine
para-aminosalicylic_acid
delamanid fbiC c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Assoc w R - Interim
c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT Assoc w R - Interim
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.28 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7892 c.591G>A synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 8013 p.Gln238Glu missense_variant 1.0 levofloxacin Uncertain significance
moxifloxacin
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
ccsA 620029 c.139C>T synonymous_variant 1.0 capreomycin Not assoc w R - Interim
amikacin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
PPE35 2170568 p.Ile15Met missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2221955 p.His404Tyr missense_variant 1.0 clofazimine Uncertain significance
bedaquiline Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
eis 2715399 c.-67T>A upstream_gene_variant 1.0 amikacin Uncertain significance
kanamycin Uncertain significance
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0 rifampicin Not assoc w R
clpC1 4038318 p.Pro796Leu missense_variant 1.0 pyrazinamide Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
whiB6 4338293 p.Ala77Thr missense_variant 1.0 capreomycin
amikacin
kanamycin
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin