TB-Profiler result

Run: SRR18912993

Summary

Run ID: SRR18912993

Sample name:

Date: 03-04-2023 20:49:36

Number of reads: 116309

Percentage reads mapped: 99.75

Strain: lineage4.9

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5086 c.-154A>G upstream_gene_variant 0.29
gyrB 5149 c.-91G>A upstream_gene_variant 0.25
gyrB 5413 p.Met58Ile missense_variant 1.0
gyrB 6597 p.Ser453Tyr missense_variant 0.29
gyrA 7362 p.Glu21Arg missense_variant 1.0
gyrA 9353 c.2052G>A synonymous_variant 0.22
gyrA 9397 p.Gly699Asp missense_variant 0.29
fgd1 491133 c.351A>G synonymous_variant 0.4
rpoB 759620 c.-187A>C upstream_gene_variant 0.67
rpoB 760249 p.Met148Thr missense_variant 0.33
rpoB 762579 c.2777delT frameshift_variant 0.5
rpoC 766123 c.2754C>A synonymous_variant 0.18
rpoC 766441 c.3072C>A synonymous_variant 0.25
mmpL5 776561 c.1920G>A synonymous_variant 0.17
mmpL5 776887 c.1593delC frameshift_variant 0.33
mmpR5 779476 p.Glu163Gln missense_variant 1.0
rpsL 781706 c.147T>G synonymous_variant 0.15
embR 1416629 p.Gly240Asp missense_variant 0.15
embR 1417168 p.Trp60Cys missense_variant 0.67
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1473293 n.1448G>C non_coding_transcript_exon_variant 0.33
rrl 1474719 n.1062G>A non_coding_transcript_exon_variant 0.25
rpsA 1833903 p.Glu121Gly missense_variant 0.29
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102581 c.462T>C synonymous_variant 0.29
katG 2154086 p.Gly676Trp missense_variant 0.4
katG 2154508 p.Asn535Ile missense_variant 0.29
katG 2155596 c.516G>T synonymous_variant 0.5
katG 2155675 p.Arg146Gln missense_variant 0.4
PPE35 2168189 c.2349_2423delGTTTACGCTGCCGCAGCTCAGCATCCCGGCGATTACCACCCCGGCGTTCACGATCGATCCGATAGCGCTGGGTGG disruptive_inframe_deletion 0.67
PPE35 2169071 c.1542A>C synonymous_variant 0.67
Rv1979c 2222430 p.Met245Ile missense_variant 0.29
kasA 2518759 c.645C>A synonymous_variant 1.0
folC 2746793 p.Gln269Leu missense_variant 0.25
pepQ 2860181 p.Gly80Arg missense_variant 0.29
Rv2752c 3065480 p.Phe238Leu missense_variant 0.33
Rv3083 3449379 c.876G>T synonymous_variant 0.29
Rv3083 3449510 p.Glu336Gly missense_variant 0.2
fbiA 3641410 p.Val290Met missense_variant 0.18
alr 3841244 c.177G>A synonymous_variant 0.2
alr 3841504 c.-84C>A upstream_gene_variant 0.12
clpC1 4039484 c.1221T>G synonymous_variant 0.56
clpC1 4040745 c.-41G>C upstream_gene_variant 0.25
panD 4044297 c.-16C>T upstream_gene_variant 0.25
embC 4241246 p.Arg462Trp missense_variant 0.4
embB 4247646 p.Glu378Gly missense_variant 0.67
embB 4248817 c.2304C>T synonymous_variant 0.67
aftB 4267164 p.Trp558Leu missense_variant 0.33
aftB 4268079 p.Gly253Asp missense_variant 0.4
whiB6 4338594 c.-73T>G upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0