TB-Profiler result

Run: SRR18913747

Summary

Run ID: SRR18913747

Sample name:

Date: 03-04-2023 20:50:18

Number of reads: 1288165

Percentage reads mapped: 97.12

Strain: lineage4.5

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7100 c.-202T>C upstream_gene_variant 0.1
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 0.98
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 8345 c.1044C>T synonymous_variant 0.98
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
rpoC 763966 c.597C>T synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.19
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1473927 n.270C>T non_coding_transcript_exon_variant 0.12
rrl 1475819 n.2162C>A non_coding_transcript_exon_variant 0.12
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102436 p.His203Tyr missense_variant 1.0
PPE35 2167926 p.Leu896Ser missense_variant 0.1
PPE35 2168774 c.1838dupC frameshift_variant 1.0
PPE35 2169661 p.Asn318Tyr missense_variant 0.91
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2860225 p.Ala65Asp missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 0.98
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0