TB-Profiler result

Run: SRR19221481
Summary

Run ID: SRR19221481

Sample name:

Date: 03-04-2023 20:58:14

Number of reads: 1735252

Percentage reads mapped: 99.64

Strain: lineage4.6.2.2

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.6 Euro-American T;LAM None 1.0
lineage4.6.2 Euro-American T;LAM RD726 1.0
lineage4.6.2.2 Euro-American (Cameroon) LAM10-CAM RD726 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5864 p.Thr209Ala missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpR5 778298 c.-692C>T upstream_gene_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.16
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474196 n.539G>T non_coding_transcript_exon_variant 0.12
rrl 1474599 n.942T>C non_coding_transcript_exon_variant 0.11
rrl 1475060 n.1403A>G non_coding_transcript_exon_variant 0.5
rrl 1476051 n.2394G>T non_coding_transcript_exon_variant 0.17
inhA 1673393 c.-809G>C upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2221746 c.1416_1418dupCCG disruptive_inframe_insertion 0.99
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv3083 3448567 p.His22Asp missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
ddn 3987011 c.168C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
aftB 4267272 p.Lys522Arg missense_variant 1.0
ethR 4326739 c.-810G>C upstream_gene_variant 1.0
ethA 4328004 c.-531C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0