TB-Profiler result

Run: SRR19315462
Summary

Run ID: SRR19315462

Sample name:

Date: 03-04-2023 21:26:53

Number of reads: 1938123

Percentage reads mapped: 99.76

Strain: lineage4.7

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.7 Euro-American (mainly T) T1;T5 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7904 c.603G>C synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474294 n.637C>G non_coding_transcript_exon_variant 0.97
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168975 c.1560_1637delTAACATCACGGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCCAGCTACAACGACACCAGC disruptive_inframe_deletion 1.0
PPE35 2169056 c.1557A>G synonymous_variant 0.16
PPE35 2169063 p.Met517Thr missense_variant 0.14
PPE35 2169066 p.Ala516Val missense_variant 0.14
PPE35 2169071 c.1542A>G synonymous_variant 0.14
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
embC 4241256 p.Arg465Thr missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4249732 c.3219C>G synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2168975 c.1559_1637delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0