TB-Profiler result

Run: SRR6981986

Summary

Run ID: SRR6981986

Sample name:

Date: 04-04-2023 18:23:48

Number of reads: 268844

Percentage reads mapped: 99.5

Strain: lineage4.3.4.2.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 0.96
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 0.76
lineage4.3.4.2.1 Euro-American (LAM) LAM11 RD174 0.75
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5181 c.-59G>A upstream_gene_variant 0.11
gyrB 6140 p.Val301Leu missense_variant 0.68
gyrA 7222 c.-80C>T upstream_gene_variant 0.13
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7971 p.Lys224Glu missense_variant 0.12
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoB 761686 p.Arg627His missense_variant 0.17
rpoC 764252 p.Arg295Trp missense_variant 0.22
rpoC 764380 c.1011G>A synonymous_variant 0.14
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776282 c.2199G>T synonymous_variant 0.22
mmpL5 776970 p.Gln504Arg missense_variant 0.25
mmpL5 778828 c.-348G>A upstream_gene_variant 0.15
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 800757 c.-52G>A upstream_gene_variant 0.13
fbiC 1303616 p.Ala229Val missense_variant 0.12
fbiC 1303806 c.876G>A synonymous_variant 0.12
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.5
Rv1258c 1406980 p.Met121Val missense_variant 0.17
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474068 n.411T>C non_coding_transcript_exon_variant 0.12
rrl 1474303 n.646A>C non_coding_transcript_exon_variant 0.13
rpsA 1834770 p.Gln410Arg missense_variant 0.1
tlyA 1917972 c.33A>G synonymous_variant 1.0
tlyA 1918394 p.Val152Glu missense_variant 0.11
katG 2155214 p.Trp300Arg missense_variant 0.22
PPE35 2169689 c.924C>A synonymous_variant 0.12
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2714895 p.Phe146Leu missense_variant 0.12
eis 2714926 p.Thr136Ser missense_variant 0.8
eis 2715094 p.Ala80Val missense_variant 0.25
folC 2746913 p.Asp229Val missense_variant 0.13
pepQ 2860163 c.256C>A synonymous_variant 0.33
Rv2752c 3066232 c.-41T>C upstream_gene_variant 0.15
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
ald 3087506 c.690delA frameshift_variant 0.1
ald 3087522 p.Val235Met missense_variant 0.1
Rv3083 3449251 p.Ile250Val missense_variant 0.2
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474133 p.Pro43Thr missense_variant 0.25
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
fbiA 3641071 p.Arg177Cys missense_variant 0.14
fbiB 3642023 c.489C>T synonymous_variant 0.15
alr 3840255 p.Glu389Gly missense_variant 0.12
alr 3840719 c.702A>G synonymous_variant 0.8
ddn 3987161 c.318G>T synonymous_variant 0.11
clpC1 4038287 c.2418C>T synonymous_variant 1.0
panD 4044333 c.-52C>T upstream_gene_variant 0.87
embC 4240275 p.Pro138Leu missense_variant 0.22
embC 4240964 p.Gly368Arg missense_variant 0.2
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4245356 c.2124C>A synonymous_variant 0.29
embB 4247057 p.Arg182Cys missense_variant 0.2
embB 4249401 p.Val963Glu missense_variant 0.29
ethA 4326456 p.Thr340Ala missense_variant 0.11
ethA 4327815 c.-342G>T upstream_gene_variant 0.29
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338697 c.-176T>C upstream_gene_variant 0.12
gid 4407914 p.Arg97Cys missense_variant 0.13
gid 4408156 p.Leu16Arg missense_variant 1.0