TB-Profiler result

Run: DRR034507
Summary

Run ID: DRR034507

Sample name:

Date: 31-03-2023 07:00:54

Number of reads: 869939

Percentage reads mapped: 98.98

Strain: lineage4.2

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.2 Euro-American H;T;LAM None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 7121 p.Pro628Ala missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576077 c.730C>T synonymous_variant 1.0
mshA 576643 c.1296C>T synonymous_variant 1.0
ccsA 620063 p.Ser58Ile missense_variant 0.12
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.18
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
folC 2746660 c.938delT frameshift_variant 0.12
ribD 2987302 p.Arg155Gln missense_variant 0.14
Rv2752c 3066280 c.-89C>T upstream_gene_variant 1.0
ald 3086733 c.-87G>T upstream_gene_variant 1.0
ald 3086742 c.-78A>C upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473922 c.-85T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fbiB 3642790 p.Glu419Gly missense_variant 0.12
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242711 p.Gln950Arg missense_variant 0.1
embA 4244400 p.Leu390Met missense_variant 1.0
embB 4249533 p.Ala1007Val missense_variant 1.0
aftB 4267893 p.Ile315Thr missense_variant 0.14
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0