TB-Profiler result

Run: DRR189052

Summary

Run ID: DRR189052

Sample name:

Date: 31-03-2023 07:51:03

Number of reads: 2408330

Percentage reads mapped: 99.55

Strain: lineage4.1.2

Drug-resistance: Other


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpsL 781822 p.Lys88Arg missense_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.28
embR 1417140 p.Ala70Ser missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1473204 n.1359C>T non_coding_transcript_exon_variant 0.15
fabG1 1673249 c.-191C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154493 p.Phe540Cys missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
folC 2747022 p.Val193Ile missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448894 p.Tyr131Asp missense_variant 1.0
Rv3083 3449642 p.Asn380Ser missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fbiA 3641164 p.Ile208Val missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0