TB-Profiler result

Run: ERR11068866

Summary

Run ID: ERR11068866

Sample name:

Date: 07-04-2023 05:03:37

Number of reads: 3145389

Percentage reads mapped: 99.68

Strain: lineage4.7

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.7 Euro-American (mainly T) T1;T5 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 8432 c.1131C>G synonymous_variant 1.0
fgd1 490658 c.-124_-71delGGAGCGAGCGCGAGCGCGGCAAGCCGGGTGCCGCGGGTCGCGACCATGGGATAT upstream_gene_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474294 n.637C>G non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
thyX 3068022 c.-77C>G upstream_gene_variant 1.0
rpoA 3878641 c.-134C>G upstream_gene_variant 0.25
ddn 3986975 c.132T>C synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4247024 p.Pro171Ala missense_variant 0.2
embB 4249732 c.3219C>G synonymous_variant 0.99
whiB6 4338595 c.-75delG upstream_gene_variant 1.0