TB-Profiler result

Run: ERR1213882
Summary

Run ID: ERR1213882

Sample name:

Date: 31-03-2023 12:42:33

Number of reads: 2873969

Percentage reads mapped: 99.51

Strain: lineage4.4.1.1

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.4 Euro-American S;T None 0.99
lineage4.4.1 Euro-American (S-type) S;T None 0.99
lineage4.4.1.1 Euro-American S;Orphans None 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
embB 4247431 p.Met306Ile missense_variant 1.0 ethambutol
gid 4408087 c.115delC frameshift_variant 0.96 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776378 p.Phe701Leu missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475728 n.2071C>T non_coding_transcript_exon_variant 0.17
fabG1 1673389 c.-51C>G upstream_gene_variant 0.2
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102990 p.Val18Ala missense_variant 1.0
PPE35 2169320 p.Leu431Phe missense_variant 0.22
PPE35 2169840 p.Gly258Asp missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289594 c.-393_-354delAGATGTACGAAACCGTCGTTGTATCAACGGTGGTAATGCA upstream_gene_variant 1.0
ribD 2986827 c.-12G>A upstream_gene_variant 0.96
ribD 2987307 p.Ala157Pro missense_variant 0.44
Rv2752c 3066097 p.Thr32Met missense_variant 1.0
thyA 3073806 c.666C>G synonymous_variant 0.21
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448608 c.105G>A synonymous_variant 0.97
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612665 p.Val151Ala missense_variant 0.94
clpC1 4038857 c.1848C>A synonymous_variant 0.42
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0