TB-Profiler result

Run: ERR1679587
Summary

Run ID: ERR1679587

Sample name:

Date: 31-03-2023 14:55:00

Number of reads: 1063236

Percentage reads mapped: 99.58

Strain: lineage4.6.2.2

Drug-resistance: MDR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.6 Euro-American T;LAM None 1.0
lineage4.6.2 Euro-American T;LAM RD726 1.0
lineage4.6.2.2 Euro-American (Cameroon) LAM10-CAM RD726 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761110 p.Asp435Val missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491327 p.Ala182Val missense_variant 0.1
ccsA 620122 p.Arg78Trp missense_variant 0.11
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpR5 778298 c.-692C>T upstream_gene_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102090 c.951_952dupGT frameshift_variant 0.1
PPE35 2170001 c.612C>T synonymous_variant 0.17
Rv1979c 2221746 c.1416_1418dupCCG disruptive_inframe_insertion 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ahpC 2726407 p.Asn72Ser missense_variant 1.0
Rv3083 3448567 p.His22Asp missense_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fbiB 3641923 p.Ala130Val missense_variant 0.17
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4247468 p.Tyr319Asp missense_variant 1.0
aftB 4267272 p.Lys522Arg missense_variant 1.0
ubiA 4269309 p.Trp175Cys missense_variant 1.0
ethA 4326715 p.Cys253Trp missense_variant 1.0
ethR 4326739 c.-810G>C upstream_gene_variant 1.0
ethA 4328004 c.-531C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407758 p.Ser149Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0