TB-Profiler result

Run: ERR2515699

Summary

Run ID: ERR2515699

Sample name:

Date: 31-03-2023 21:04:15

Number of reads: 429043

Percentage reads mapped: 99.73

Strain: lineage4.8

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
fgd1 491100 c.318C>T synonymous_variant 1.0
rpoC 763890 p.Ala174Glu missense_variant 0.12
rpoC 763980 p.Glu204Ala missense_variant 0.11
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776647 p.Val612Ile missense_variant 1.0
mmpL5 777925 p.Val186Ile missense_variant 0.14
mmpR5 779480 p.Asp164Gly missense_variant 0.14
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1302806 c.-125C>G upstream_gene_variant 0.11
fbiC 1302835 c.-96C>A upstream_gene_variant 0.1
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.25
Rv1258c 1406277 p.Leu355Pro missense_variant 0.13
Rv1258c 1406651 p.Met230Ile missense_variant 0.12
Rv1258c 1407231 p.Arg37Pro missense_variant 0.11
Rv1258c 1407272 c.69T>C synonymous_variant 0.11
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
rrl 1476002 n.2345T>A non_coding_transcript_exon_variant 0.11
fabG1 1673881 p.Gly148Cys missense_variant 0.14
inhA 1674197 c.-5C>T upstream_gene_variant 0.13
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102773 c.270C>T synonymous_variant 0.12
katG 2154396 c.1716G>T synonymous_variant 0.12
PPE35 2167969 c.2632_2643delGGATTCGCAATC conservative_inframe_deletion 0.22
PPE35 2168524 p.Gly697Ser missense_variant 1.0
PPE35 2170413 p.Ala67Glu missense_variant 0.29
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289395 c.-154C>T upstream_gene_variant 0.12
pncA 2289459 c.-223_-219dupACCTG upstream_gene_variant 0.11
pncA 2289782 c.-541A>G upstream_gene_variant 0.11
pncA 2289846 c.-605C>T upstream_gene_variant 0.14
kasA 2518954 c.840C>A synonymous_variant 0.11
eis 2715024 c.309A>G synonymous_variant 0.11
eis 2715435 c.-103C>A upstream_gene_variant 0.13
eis 2715561 c.-229G>C upstream_gene_variant 0.11
ahpC 2725940 c.-253A>G upstream_gene_variant 0.12
pepQ 2860462 c.-44C>G upstream_gene_variant 0.17
fprA 3475277 p.Gln424Leu missense_variant 0.12
fbiA 3641182 p.Ser214Pro missense_variant 0.13
fbiB 3641909 c.375T>C synonymous_variant 0.17
fbiB 3642134 c.600G>A synonymous_variant 0.13
alr 3840764 c.657G>C synonymous_variant 1.0
rpoA 3878469 c.39C>A synonymous_variant 0.17
ddn 3987108 p.Tyr89His missense_variant 0.13
ddn 3987114 p.Asn91His missense_variant 0.15
clpC1 4038223 p.Ala828Thr missense_variant 0.11
clpC1 4038344 c.2360delA frameshift_variant 0.14
clpC1 4039332 p.Val458Ala missense_variant 0.11
clpC1 4040854 c.-150T>C upstream_gene_variant 0.11
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243862 c.632_633delTG frameshift_variant 0.11
embA 4245552 p.Pro774Ser missense_variant 1.0
embB 4248040 c.1527C>T synonymous_variant 0.11
embB 4249395 p.Ile961Thr missense_variant 0.1
ethA 4327181 p.Ile98Thr missense_variant 0.11
whiB6 4338361 p.Arg54Leu missense_variant 0.15
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0