TB-Profiler result

Run: ERR2515781

Summary

Run ID: ERR2515781

Sample name:

Date: 31-03-2023 21:07:05

Number of reads: 1424456

Percentage reads mapped: 99.82

Strain: lineage4.9

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761139 p.His445Asp missense_variant 1.0 rifampicin
inhA 1674481 p.Ser94Ala missense_variant 1.0 isoniazid, ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.19
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv3083 3449713 p.Ala404Thr missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0