TB-Profiler result

Run: ERR2652978
Summary

Run ID: ERR2652978

Sample name:

Date: 31-03-2023 22:25:45

Number of reads: 1247603

Percentage reads mapped: 99.42

Strain: lineage4.3.4.2.1

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
lineage4.3.4.2.1 Euro-American (LAM) LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6140 p.Val301Leu missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 0.99
gyrA 9760 p.Glu820Gly missense_variant 0.98
fgd1 490751 c.-32T>G upstream_gene_variant 0.29
mshA 576551 p.Ile402Val missense_variant 0.1
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1303157 p.His76Arg missense_variant 0.11
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.29
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170048 p.Leu189Val missense_variant 0.1
PPE35 2170053 p.Thr187Ser missense_variant 0.1
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2859939 c.480C>T synonymous_variant 0.11
thyX 3067399 p.Ile183Val missense_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086740 c.-80A>G upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fbiD 3339654 c.537A>G synonymous_variant 0.13
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
alr 3840719 c.702A>G synonymous_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embC 4241163 p.Leu434Ser missense_variant 0.1
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0