TB-Profiler result

Run: ERR2851360
Summary

Run ID: ERR2851360

Sample name:

Date: 31-03-2023 23:52:49

Number of reads: 440780

Percentage reads mapped: 96.43

Strain: lineage4.7

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.7 Euro-American (mainly T) T1;T5 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 8353 p.Gly351Ala missense_variant 1.0
ccsA 620498 c.611delG frameshift_variant 0.17
rpoB 762756 p.Ser984Pro missense_variant 0.13
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 775700 c.2781G>T synonymous_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1303116 c.186C>T synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475699 n.2042C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2859574 p.Ala282Val missense_variant 0.12
Rv2752c 3065039 p.Tyr385His missense_variant 0.1
rpoA 3878343 c.165C>T synonymous_variant 0.14
embC 4239862 c.-1G>A upstream_gene_variant 0.17
embC 4240153 c.291G>A synonymous_variant 0.12
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243700 c.475_516delGCCGGGACCCTGCCGCCGGAGAAGAAGCCACAGGTTGGCGGC conservative_inframe_deletion 0.14
embB 4246626 p.Phe38Ser missense_variant 0.11
embB 4247022 p.Ala170Glu missense_variant 0.12
embB 4249732 c.3219C>G synonymous_variant 1.0
aftB 4267158 c.1678delA frameshift_variant 0.11
ethR 4327828 p.Pro94Ser missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407590 p.Ala205Thr missense_variant 1.0