TB-Profiler result

Run: ERR4407487

Summary

Run ID: ERR4407487

Sample name:

Date: 01-04-2023 05:46:04

Number of reads: 1373476

Percentage reads mapped: 99.22

Strain: lineage4.3.3

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.3 Euro-American (LAM) LAM;T RD115 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8040 p.Gly247Ser missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 763925 p.Ala186Thr missense_variant 0.12
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.12
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518919 p.Gly269Ser missense_variant 0.98
folC 2746591 c.1008C>T synonymous_variant 1.0
Rv2752c 3065824 p.Pro123Leu missense_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3449024 c.523delT frameshift_variant 0.29
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474450 c.444C>G synonymous_variant 1.0
rpoA 3878646 c.-139G>T upstream_gene_variant 0.25
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407721 p.Ala161Gly missense_variant 1.0
gid 4407948 p.Asp85Glu missense_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0