TB-Profiler result

Run: ERR4816582
Summary

Run ID: ERR4816582

Sample name:

Date: 01-04-2023 14:30:53

Number of reads: 1904132

Percentage reads mapped: 99.26

Strain: lineage4.1.1.3

Drug-resistance: Other

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
lineage4.1.1.3 Euro-American (X-type) X1;X3 RD193 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rrs 1472733 n.888G>A non_coding_transcript_exon_variant 0.27 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 490658 c.-124_-71delGGAGCGAGCGCGAGCGCGGCAAGCCGGGTGCCGCGGGTCGCGACCATGGGATAT upstream_gene_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472599 n.754G>T non_coding_transcript_exon_variant 0.11
rrs 1472616 n.771G>A non_coding_transcript_exon_variant 0.33
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.38
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.38
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.3
rrs 1472668 n.825_829delGGGTT non_coding_transcript_exon_variant 0.33
rrs 1472675 n.830_831insAGAC non_coding_transcript_exon_variant 0.33
rrs 1472680 n.835C>T non_coding_transcript_exon_variant 0.28
rrs 1472682 n.837T>C non_coding_transcript_exon_variant 0.28
rrs 1472683 n.838T>G non_coding_transcript_exon_variant 0.28
rrs 1472687 n.842A>T non_coding_transcript_exon_variant 0.28
rrs 1472689 n.844C>T non_coding_transcript_exon_variant 0.26
rrs 1472690 n.845C>A non_coding_transcript_exon_variant 0.32
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.11
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.26
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.26
rrs 1472742 n.897C>T non_coding_transcript_exon_variant 0.21
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.24
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2156096 p.Pro6Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pepQ 2859886 p.Ala178Val missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4249408 c.2895G>A synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0