TB-Profiler result

Run: ERR551550

Summary

Run ID: ERR551550

Sample name:

Date: 02-08-2023 08:30:13

Number of reads: NA

Percentage reads mapped: NA

Strain: lineage4.8

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
ccsA 619831 c.-60T>G upstream_gene_variant 0.27
ccsA 620748 c.858T>G synonymous_variant 0.35
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 775898 p.Glu861Asp missense_variant 0.13
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304438 p.Glu503Gly missense_variant 0.15
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.38
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168149 p.Pro822Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ahpC 2726241 p.Ala17Thr missense_variant 0.24
clpC1 4039729 p.Asp326Asn missense_variant 1.0
embC 4241875 c.2013G>A synonymous_variant 0.12
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0