TB-Profiler result

Run: ERR6865431

Summary

Run ID: ERR6865431

Sample name:

Date: 02-04-2023 02:54:03

Number of reads: 2306814

Percentage reads mapped: 99.75

Strain: lineage4.3.3;lineage4.1.4

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 0.49
lineage4.1 Euro-American T;X;H None 0.53
lineage4.1.4 Euro-American T;X;H None 0.51
lineage4.3.3 Euro-American (LAM) LAM;T RD115 0.47
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8040 p.Gly247Ser missense_variant 0.53
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 490658 c.-124_-71delGGAGCGAGCGCGAGCGCGGCAAGCCGGGTGCCGCGGGTCGCGACCATGGGATAT upstream_gene_variant 0.21
rpoC 764995 c.1626C>G synonymous_variant 0.51
rpoC 765150 p.Gly594Glu missense_variant 0.49
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 778042 p.Ala147Thr missense_variant 0.54
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170038 p.Ala192Val missense_variant 0.53
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518919 p.Gly269Ser missense_variant 0.45
thyA 3073868 p.Thr202Ala missense_variant 0.46
ald 3086788 c.-32T>C upstream_gene_variant 0.98
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 0.52
embC 4242182 p.Ala774Ser missense_variant 0.48
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 0.51
embB 4249408 c.2895G>A synonymous_variant 0.51
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 0.55