TB-Profiler result

Run: ERR718488

Summary

Run ID: ERR718488

Sample name:

Date: 02-04-2023 04:06:14

Number of reads: 3978697

Percentage reads mapped: 99.57

Strain: lineage4.5

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
ahpC 2726141 c.-52C>T upstream_gene_variant 1.0 isoniazid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 0.99
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
rpoB 760848 p.Thr348Ala missense_variant 1.0
rpoC 765609 p.Asp747Gly missense_variant 0.97
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 0.99
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2155645 p.Gly156Asp missense_variant 1.0
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
ddn 3987205 c.363_386delATATTGGCCACAGTTGGTCACGAT disruptive_inframe_deletion 1.0
clpC1 4038318 p.Pro796Leu missense_variant 1.0
embC 4240528 c.666C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 0.99
embA 4244679 p.Ala483Thr missense_variant 0.99
ethA 4326262 c.1212C>T synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408069 p.Trp45Ser missense_variant 1.0