TB-Profiler result

Run: ERR7764409
Summary

Run ID: ERR7764409

Sample name:

Date: 02-04-2023 05:46:52

Number of reads: 1776818

Percentage reads mapped: 99.61

Strain: lineage4.3.4.1

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 0.99
lineage4.3.4.1 Euro-American (LAM) LAM1;LAM2 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576089 c.750_769delTGATCGGCGCGCGGCCCGGG frameshift_variant 0.6
mshA 576616 c.1269G>C synonymous_variant 0.33
rpoC 764367 p.Gly333Ala missense_variant 0.36
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1476252 n.2595T>C non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170048 p.Leu189Val missense_variant 0.18
PPE35 2170053 p.Thr187Ser missense_variant 0.2
Rv1979c 2222854 p.Ile104Thr missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2519071 p.Asp319Glu missense_variant 0.19
pepQ 2860159 p.Ala87Gly missense_variant 0.26
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fbiD 3339734 p.Ala206Gly missense_variant 0.6
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
rpoA 3877509 c.999G>A synonymous_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
clpC1 4039991 c.714G>A synonymous_variant 1.0
embC 4240409 p.Pro183Ala missense_variant 0.19
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4245835 p.Leu868Arg missense_variant 0.35
embB 4246527 p.Ala5Gly missense_variant 0.33
embB 4247016 p.Ser168Trp missense_variant 0.4
embB 4247028 p.Leu172Arg missense_variant 0.38
embB 4247033 p.Ser174Arg missense_variant 0.29
aftB 4268619 p.Val73Gly missense_variant 0.31
aftB 4268623 p.Trp72Gly missense_variant 0.27
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0