TB-Profiler result

Run: ERR7801251
Summary

Run ID: ERR7801251

Sample name:

Date: 02-04-2023 06:00:25

Number of reads: 924869

Percentage reads mapped: 99.67

Strain: lineage4.3.4.2.1

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 0.99
lineage4.3.4.2.1 Euro-American (LAM) LAM11 RD174 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6140 p.Val301Leu missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoB 761728 p.Ser641Ile missense_variant 0.11
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1303535 p.Ser202* stop_gained 0.15
Rv1258c 1407158 c.183C>A synonymous_variant 0.13
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475114 n.1457C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102395 c.648C>G synonymous_variant 1.0
PPE35 2170048 p.Leu189Val missense_variant 0.24
PPE35 2170053 p.Thr187Ser missense_variant 0.21
PPE35 2170325 p.Glu96Asp missense_variant 0.2
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
thyX 3067255 p.Glu231* stop_gained 0.19
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448966 c.473_496delGGTTCGGCGGCCGGTGCGTGCACC disruptive_inframe_deletion 0.13
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fprA 3474143 p.Trp46Leu missense_variant 0.17
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
Rv3236c 3612782 p.Gly112Val missense_variant 0.17
Rv3236c 3612903 p.Ala72Thr missense_variant 0.22
fbiB 3641634 p.Ala34Thr missense_variant 0.12
fbiB 3642110 c.576C>T synonymous_variant 0.2
alr 3840719 c.702A>G synonymous_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
panD 4043938 p.Ile115Thr missense_variant 1.0
embA 4242382 c.-851C>A upstream_gene_variant 0.12
embC 4242596 p.Gly912Ser missense_variant 0.15
embC 4242635 p.Ala925Ser missense_variant 0.17
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4242754 c.-479G>T upstream_gene_variant 0.13
embA 4244946 p.Val572Leu missense_variant 0.14
embB 4249604 p.Gly1031Cys missense_variant 0.14
aftB 4268564 c.273G>A synonymous_variant 0.14
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407665 p.Ala180Ser missense_variant 0.15
gid 4408156 p.Leu16Arg missense_variant 1.0