TB-Profiler result

Run: ERR9786734

Summary

Run ID: ERR9786734

Sample name:

Date: 02-04-2023 12:42:11

Number of reads: 922881

Percentage reads mapped: 99.84

Strain: lineage4.3.4.2

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6140 p.Val301Leu missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2154700 p.Gln471Arg missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2519132 c.1019_1057delAGTCTGCGCTGGGCCACTCGATCGGCGCGGTCGGTGCGC disruptive_inframe_deletion 0.11
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473998 c.-9G>A upstream_gene_variant 1.0
fprA 3473998 c.-10_-9insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
Rv3236c 3612407 p.His237Arg missense_variant 1.0
alr 3840719 c.702A>G synonymous_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
clpC1 4039676 c.1029G>A synonymous_variant 0.14
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4245842 c.-672G>A upstream_gene_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0