TB-Profiler result

Run: SRR16370201


Run ID: SRR16370201

Sample name:

Date: 03-04-2023 17:17:45

Number of reads: 1570615

Percentage reads mapped: 99.57

Strain: lineage4.4.1.1

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.4 Euro-American S;T None 1.0
lineage4.4.1 Euro-American (S-type) S;T None 1.0
lineage4.4.1.1 Euro-American S;Orphans None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776378 p.Phe701Leu missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475540 n.1883C>A non_coding_transcript_exon_variant 0.11
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102990 p.Val18Ala missense_variant 1.0
PPE35 2169840 p.Gly258Asp missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289594 c.-393_-354delAGATGTACGAAACCGTCGTTGTATCAACGGTGGTAATGCA upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
Rv3083 3448608 c.105G>A synonymous_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612665 p.Val151Ala missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338609 c.-88T>G upstream_gene_variant 1.0
gid 4407680 p.Arg175Gly missense_variant 1.0