TB-Profiler result

Run: SRR16370620
Summary

Run ID: SRR16370620

Sample name:

Date: 03-04-2023 17:36:54

Number of reads: 2397903

Percentage reads mapped: 99.77

Strain: lineage4

Drug-resistance: HR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
fabG1 1673423 c.-17G>T upstream_gene_variant 1.0 isoniazid, ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 0.99
rpoB 761889 p.Val695Leu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 801009 c.201A>G synonymous_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.24
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472062 n.217G>T non_coding_transcript_exon_variant 0.12
rrl 1474238 n.581G>A non_coding_transcript_exon_variant 0.29
rrl 1474670 n.1013C>A non_coding_transcript_exon_variant 0.15
rrl 1475598 n.1941G>A non_coding_transcript_exon_variant 0.15
rrl 1475767 n.2110G>A non_coding_transcript_exon_variant 0.22
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223214 c.-50A>C upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3065517 c.675C>T synonymous_variant 1.0
Rv3083 3448439 c.-64delA upstream_gene_variant 1.0
fprA 3474299 p.Asp98Gly missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ethA 4328317 c.-844C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0