TB-Profiler result

Run: SRR18213706
Summary

Run ID: SRR18213706

Sample name:

Date: 03-04-2023 19:26:05

Number of reads: 2115147

Percentage reads mapped: 99.32

Strain: lineage4.2.2.2

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.2 Euro-American H;T;LAM None 1.0
lineage4.2.2 Euro-American (Ural) T;LAM7-TUR None 1.0
lineage4.2.2.2 Euro-American (Ural) T;LAM7-TUR None 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8688 p.Ala463Ser missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mshA 576077 c.730C>T synonymous_variant 1.0
mshA 576611 p.Ala422Thr missense_variant 0.22
rpoB 759620 c.-187A>C upstream_gene_variant 0.22
rpoB 761489 c.1683G>A synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304159 p.Val410Gly missense_variant 0.28
fbiC 1304189 p.Pro420Gln missense_variant 0.17
Rv1258c 1406919 p.Arg141Leu missense_variant 0.19
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2169320 p.Leu431Phe missense_variant 0.16
PPE35 2170062 p.Ala184Val missense_variant 0.4
PPE35 2170281 p.Ala111Val missense_variant 0.22
Rv1979c 2223293 c.-129A>G upstream_gene_variant 0.98
ahpC 2726338 p.Val49Gly missense_variant 0.36
ribD 2987323 p.Val162Gly missense_variant 0.28
Rv2752c 3066280 c.-89C>T upstream_gene_variant 1.0
ald 3086742 c.-78A>C upstream_gene_variant 0.98
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
fbiB 3641986 p.Thr151Ile missense_variant 0.14
rpoA 3878161 c.326_346delACATCGTGCCGCCGGCCGGCG disruptive_inframe_deletion 0.17
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244274 p.Gly348Arg missense_variant 0.13
embA 4244569 p.Arg446Pro missense_variant 0.15
whiB6 4338595 c.-75delG upstream_gene_variant 1.0