TB-Profiler result

Run: SRR2101571

Summary

Run ID: SRR2101571

Sample name:

Date: 03-04-2023 23:47:50

Number of reads: 701243

Percentage reads mapped: 99.14

Strain: lineage4.1.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.28
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472164 n.319G>A non_coding_transcript_exon_variant 0.98
rrl 1473538 n.-120A>G upstream_gene_variant 1.0
rrl 1476251 n.2594T>C non_coding_transcript_exon_variant 0.11
rrl 1476260 n.2603A>G non_coding_transcript_exon_variant 0.12
rrl 1476280 n.2623A>C non_coding_transcript_exon_variant 0.11
rrl 1476293 n.2636C>T non_coding_transcript_exon_variant 0.12
rrl 1476294 n.2637A>G non_coding_transcript_exon_variant 0.12
rrl 1476295 n.2638C>G non_coding_transcript_exon_variant 0.11
rrl 1476296 n.2639C>T non_coding_transcript_exon_variant 0.11
rrl 1476297 n.2640C>T non_coding_transcript_exon_variant 0.11
rrl 1476301 n.2644A>C non_coding_transcript_exon_variant 0.11
rrl 1476302 n.2645G>A non_coding_transcript_exon_variant 0.11
rrl 1476311 n.2654G>C non_coding_transcript_exon_variant 0.12
rrl 1476312 n.2655T>C non_coding_transcript_exon_variant 0.12
rrl 1476313 n.2656G>A non_coding_transcript_exon_variant 0.13
rrl 1476332 n.2675G>C non_coding_transcript_exon_variant 0.14
rrl 1476353 n.2696G>T non_coding_transcript_exon_variant 0.19
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.19
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.22
rrl 1476382 n.2725A>G non_coding_transcript_exon_variant 0.23
rrl 1476383 n.2726T>A non_coding_transcript_exon_variant 0.23
rrl 1476408 n.2751G>A non_coding_transcript_exon_variant 0.23
rrl 1476425 n.2768G>T non_coding_transcript_exon_variant 0.21
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.18
rrl 1476429 n.2772A>C non_coding_transcript_exon_variant 0.18
rrl 1476466 n.2809C>T non_coding_transcript_exon_variant 0.24
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.22
tlyA 1917806 c.-134T>G upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2169311 c.1300_1301dupAC frameshift_variant 0.12
PPE35 2170624 c.-12A>T upstream_gene_variant 0.11
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2519329 c.1215C>T synonymous_variant 0.12
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
whiB7 3568845 c.-166G>A upstream_gene_variant 1.0
Rv3236c 3612434 p.Ile228Asn missense_variant 0.1
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4246665 p.Gln51Pro missense_variant 1.0
embB 4249408 c.2895G>A synonymous_variant 1.0
aftB 4267902 c.934delG frameshift_variant 0.11
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0