TB-Profiler result

Run: SRR21576558

Summary

Run ID: SRR21576558

Sample name:

Date: 04-04-2023 02:07:47

Number of reads: 1975013

Percentage reads mapped: 99.28

Strain: lineage4.5

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761139 p.His445Asp missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
embB 4247431 p.Met306Ile missense_variant 0.98 ethambutol
embB 4247730 p.Gly406Asp missense_variant 0.99 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
rpoC 764532 p.Gly388Ala missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.43
Rv1258c 1406451 p.Thr297Asn missense_variant 0.99
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475998 n.2341C>A non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170568 p.Ile15Met missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2289071 p.His57Gln missense_variant 1.0
Rv2752c 3065294 c.897dupA frameshift_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612250 c.867A>G synonymous_variant 1.0
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0
clpC1 4038318 p.Pro796Leu missense_variant 0.99
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4246166 c.-348G>A upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0