TB-Profiler result

Run: SRR21576571

Summary

Run ID: SRR21576571

Sample name:

Date: 2024-04-14T08:38:08.055407

Number of reads: 2202171

Percentage reads mapped: 99.01

Median coverage: 117.0

Strain: lineage4.5

Spoligotype:

Drug-resistance: MDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.5 Euro-American RD122 1.0
lineage4 Euro-American None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB c.1306_1308delCAG Assoc w R - Interim
c.1306_1308delCAG Mutation from literature
isoniazid inhA c.-779G>T Assoc w R - Interim Alias fabG1_c.-17G>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Met306Ile Assoc w R
pyrazinamide pncA c.-11A>G Assoc w R
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide inhA c.-779G>T Assoc w R - Interim Alias fabG1_c.-17G>T
ethA c.70delC Assoc w R
clofazimine
para-aminosalicylic_acid
delamanid fbiC c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Assoc w R - Interim
c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT Assoc w R - Interim
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761111 c.1306_1308delCAG conservative_inframe_deletion 1.0 rifampicin Assoc w R - Interim
rifampicin Mutation from literature
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.24 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim
inhA 1673423 c.-779G>T upstream_gene_variant 1.0 isoniazid Assoc w R - Interim Alias fabG1_c.-17G>T. Low-level resistance (multiple, genetically linked low-level resistance mutations are additive and confer high-level resistance)
ethionamide Assoc w R - Interim Alias fabG1_c.-17G>T
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
pncA 2289252 c.-11A>G upstream_gene_variant 1.0 pyrazinamide Assoc w R
embB 4247431 p.Met306Ile missense_variant 0.98 ethambutol Assoc w R
ethA 4327403 c.70delC frameshift_variant 1.0 ethionamide Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7892 c.591G>A synonymous_variant 1.0 levofloxacin Not assoc w R - Interim
moxifloxacin Not assoc w R - Interim
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9380 p.Met693Ile missense_variant 1.0 levofloxacin
moxifloxacin
fgd1 491417 p.Arg212Gln missense_variant 1.0 clofazimine
pretomanid
delamanid
ccsA 620029 c.139C>T synonymous_variant 1.0 capreomycin Not assoc w R - Interim
amikacin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
rpoC 763966 c.597C>T synonymous_variant 1.0 rifampicin Not assoc w R - Interim
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
katG 2155605 c.507C>T synonymous_variant 1.0 isoniazid
PPE35 2170568 p.Ile15Met missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
rpoA 3878575 c.-68C>T upstream_gene_variant 1.0 rifampicin Not assoc w R
rpoA 3879070 c.-563G>A upstream_gene_variant 1.0 rifampicin
clpC1 4038318 p.Pro796Leu missense_variant 1.0 pyrazinamide Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4243246 p.Gly5Val missense_variant 0.99 ethambutol Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
amikacin
kanamycin
gid 4408159 p.Arg15Pro missense_variant 1.0 streptomycin Uncertain significance