TB-Profiler result

Run: SRR21576680

Summary

Run ID: SRR21576680

Sample name:

Date: 04-04-2023 02:14:25

Number of reads: 1871730

Percentage reads mapped: 94.95

Strain: lineage4.5

Drug-resistance: Pre-XDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.5 Euro-American H;T RD122 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
gyrA 7582 p.Asp94Gly missense_variant 0.99 ofloxacin, moxifloxacin, levofloxacin, fluoroquinolones, ciprofloxacin
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 7619 c.318C>T synonymous_variant 0.98
gyrA 7892 c.591G>A synonymous_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9788 p.Asp829Glu missense_variant 1.0
ccsA 620029 c.139C>T synonymous_variant 1.0
rpoC 764817 p.Val483Ala missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.42
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2170568 p.Ile15Met missense_variant 0.98
Rv1979c 2221722 c.1443C>T synonymous_variant 0.97
Rv1979c 2222796 c.369C>A synonymous_variant 0.97
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
rpoA 3877777 p.Ile244Thr missense_variant 0.99
rpoA 3878575 c.-68C>T upstream_gene_variant 0.97
clpC1 4038318 p.Pro796Leu missense_variant 0.98
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4247463 p.Ser317Phe missense_variant 1.0
ubiA 4269271 p.Val188Ala missense_variant 0.99
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0