TB-Profiler result

Run: SRR21728324

Summary

Run ID: SRR21728324

Sample name:

Date: 04-04-2023 03:20:31

Number of reads: 1447232

Percentage reads mapped: 99.77

Strain: lineage4.8

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
rrl 1474160 n.503C>A non_coding_transcript_exon_variant 0.15
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168813 c.1722_1799delAGCGCTAGGTGCGTTCAATCTGCCGACGCTGAGTATTCCGTCGGTGACGGTTCCGCCGATCACGATTCCGGCTGGCAC disruptive_inframe_deletion 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2715491 c.-159G>T upstream_gene_variant 1.0
Rv2752c 3065750 p.His148Tyr missense_variant 1.0
fprA 3475012 p.Asp336Asn missense_variant 1.0
alr 3841546 c.-126C>A upstream_gene_variant 1.0
alr 3841612 c.-193_-192insC upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
aftB 4269087 c.-251G>A upstream_gene_variant 1.0
ethA 4326582 p.Asn298His missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2168813 c.1721_1799delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC frameshift_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0