TB-Profiler result

Run: SRR6207287
Summary

Run ID: SRR6207287

Sample name:

Date: 02-08-2023 15:11:43

Number of reads: NA

Percentage reads mapped: NA

Strain: lineage4.1.1.3

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 0.99
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
lineage4.1.1.3 Euro-American (X-type) X1;X3 RD193 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6883 p.Leu548Phe missense_variant 0.11
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 8754 p.Glu485Lys missense_variant 0.13
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491027 p.Asn82Thr missense_variant 0.25
mshA 576089 c.750_769delTGATCGGCGCGCGGCCCGGG frameshift_variant 0.18
rpoC 765150 p.Gly594Glu missense_variant 1.0
rpoC 765500 p.Gln711Lys missense_variant 0.1
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 775964 c.2517G>T synonymous_variant 0.12
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rplC 801178 p.Ala124Thr missense_variant 0.11
Rv1258c 1406828 c.513C>T synonymous_variant 0.12
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1476136 n.2479A>G non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
pncA 2288875 p.Arg123Cys missense_variant 0.12
folC 2747624 c.-26A>T upstream_gene_variant 0.14
thyX 3067452 p.Lys165Arg missense_variant 0.22
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
clpC1 4039090 c.1615C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embA 4244194 p.Gly321Ala missense_variant 0.13
embA 4245918 p.Trp896Arg missense_variant 0.14
embB 4248636 p.Pro708Leu missense_variant 0.12
embB 4249124 p.Gly871Arg missense_variant 0.11
embB 4249403 p.Thr964Ala missense_variant 0.13
embB 4249408 c.2895G>A synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0