TB-Profiler result

Run: SRR6896350
Summary

Run ID: SRR6896350

Sample name:

Date: 04-04-2023 18:03:16

Number of reads: 786960

Percentage reads mapped: 98.98

Strain: lineage4.8

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 0.99
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6193 p.Glu318Asp missense_variant 0.12
gyrA 7362 p.Glu21Gln missense_variant 1.0
mshA 576535 c.1188T>A synonymous_variant 0.12
ccsA 620418 c.528G>A synonymous_variant 1.0
rpoC 762737 c.-633C>A upstream_gene_variant 0.12
rpoC 765276 p.Arg636Leu missense_variant 0.12
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1304333 p.Ser468Ile missense_variant 0.11
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.18
Rv1258c 1407125 c.216C>A synonymous_variant 0.11
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1473265 n.1420C>T non_coding_transcript_exon_variant 0.11
rrl 1473577 n.-81A>T upstream_gene_variant 0.14
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2102292 p.Asp251Asn missense_variant 0.12
katG 2155470 c.642G>C synonymous_variant 0.11
PPE35 2170048 p.Leu189Val missense_variant 0.15
PPE35 2170053 p.Thr187Ser missense_variant 0.15
PPE35 2170635 c.-23C>A upstream_gene_variant 0.15
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518655 p.Ala181Ser missense_variant 0.21
kasA 2519151 p.Ser346Trp missense_variant 0.12
folC 2746676 p.Ser308Cys missense_variant 0.17
folC 2747787 c.-189C>T upstream_gene_variant 0.14
pepQ 2859527 p.Val298Ile missense_variant 1.0
Rv3083 3449312 p.Leu270Gln missense_variant 1.0
whiB7 3568730 c.-52delC upstream_gene_variant 0.11
Rv3236c 3612829 c.288T>C synonymous_variant 0.15
fbiA 3641291 p.Lys250Arg missense_variant 0.11
fbiB 3642645 p.Thr371Ser missense_variant 0.11
ddn 3987058 p.Arg72Gln missense_variant 1.0
embC 4240447 c.585G>A synonymous_variant 0.13
embC 4240630 c.768C>A synonymous_variant 0.12
embC 4240782 p.Ala307Val missense_variant 0.15
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244723 p.Gln497His missense_variant 0.11
embB 4245785 c.-729G>A upstream_gene_variant 0.12
embB 4247551 c.1038C>A synonymous_variant 0.14
aftB 4268505 p.Arg111Leu missense_variant 0.12
aftB 4268865 c.-29T>A upstream_gene_variant 0.11
ethR 4326859 c.-690C>G upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0