TB-Profiler result

Run: SRR6896366


Run ID: SRR6896366

Sample name:

Date: 04-04-2023 18:03:53

Number of reads: 1112393

Percentage reads mapped: 99.73

Strain: lineage4.8

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
fgd1 491100 c.318C>T synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776647 p.Val612Ile missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.5
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1473968 n.315delG non_coding_transcript_exon_variant 0.12
rrl 1473987 n.330G>A non_coding_transcript_exon_variant 0.1
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168524 p.Gly697Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
alr 3840764 c.657G>C synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0