TB-Profiler result

Run: ERR2041732

Summary

Run ID: ERR2041732

Sample name:

Date: 20-10-2023 18:35:36

Number of reads: NA

Percentage reads mapped: NA

Strain: lineage4.8

Drug-resistance: MDR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid
pncA 2288988 p.Leu85Pro missense_variant 1.0 pyrazinamide
gid 4407967 p.Leu79Ser missense_variant 1.0 streptomycin
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
ndh 2103117 c.-75G>A upstream_gene_variant 1.0
PPE35 2169071 c.1464_1541delGGCGGTGACGACGCCGGCCAACGTTACCGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCC disruptive_inframe_deletion 0.7
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3087095 c.276C>T synonymous_variant 1.0
clpC1 4040021 c.684A>C synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ubiA 4269308 p.Phe176Leu missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2169071 c.1463_1541delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA frameshift_variant 1.0
Rv3083 3448497 c.-6_*1408del transcript_ablation 1.0