TB-Profiler result

Run: ERR2515916

Summary

Run ID: ERR2515916

Sample name:

Date: 20-10-2023 14:10:50

Number of reads: 851946

Percentage reads mapped: 93.8

Strain: lineage4.3.4.2.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Rifampicin
Isoniazid
Ethambutol
Pyrazinamide
Streptomycin
Fluoroquinolones
Moxifloxacin
Ofloxacin
Levofloxacin
Ciprofloxacin
Aminoglycosides
Amikacin
Capreomycin
Kanamycin
Cycloserine
Ethionamide
Clofazimine
Para-aminosalicylic_acid
Delamanid
Bedaquiline
Linezolid
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 0.99
lineage4.3.4.2.1 Euro-American (LAM) LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6140 p.Val301Leu missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 0.98
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.58
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472530 n.685G>A non_coding_transcript_exon_variant 0.23
rrs 1472537 n.692C>T non_coding_transcript_exon_variant 0.22
rrs 1472541 n.696T>G non_coding_transcript_exon_variant 0.22
rrs 1472544 n.699C>G non_coding_transcript_exon_variant 0.22
rrs 1472545 n.700A>T non_coding_transcript_exon_variant 0.22
rrs 1472557 n.712G>A non_coding_transcript_exon_variant 0.37
rrs 1472570 n.725G>A non_coding_transcript_exon_variant 0.38
rrs 1472571 n.726G>C non_coding_transcript_exon_variant 0.38
rrs 1472579 n.734G>T non_coding_transcript_exon_variant 0.42
rrs 1472581 n.736A>T non_coding_transcript_exon_variant 0.44
rrs 1472655 n.810G>A non_coding_transcript_exon_variant 0.41
rrs 1472658 n.813G>A non_coding_transcript_exon_variant 0.38
rrs 1472661 n.816A>G non_coding_transcript_exon_variant 0.37
rrs 1472665 n.820G>A non_coding_transcript_exon_variant 0.36
rrs 1472669 n.824_825insTAGG non_coding_transcript_exon_variant 0.39
rrs 1472678 n.833_834delTTinsGCC non_coding_transcript_exon_variant 0.37
rrs 1472684 n.839_845delGGGATCCinsA non_coding_transcript_exon_variant 0.37
rrs 1472695 n.850C>T non_coding_transcript_exon_variant 0.36
rrs 1472697 n.852T>C non_coding_transcript_exon_variant 0.38
rrs 1472713 n.868T>C non_coding_transcript_exon_variant 0.41
rrs 1472716 n.871C>T non_coding_transcript_exon_variant 0.42
rrs 1472734 n.889C>T non_coding_transcript_exon_variant 0.5
rrs 1472741 n.896G>A non_coding_transcript_exon_variant 0.49
rrs 1472744 n.899A>G non_coding_transcript_exon_variant 0.49
rrs 1472781 n.936C>T non_coding_transcript_exon_variant 0.5
rrs 1472793 n.948A>T non_coding_transcript_exon_variant 0.48
rrs 1472803 n.958T>A non_coding_transcript_exon_variant 0.46
rrs 1472824 n.979T>A non_coding_transcript_exon_variant 0.36
rrs 1472827 n.982G>T non_coding_transcript_exon_variant 0.32
rrs 1472828 n.983T>C non_coding_transcript_exon_variant 0.32
rrs 1472836 n.991G>C non_coding_transcript_exon_variant 0.29
rrs 1472837 n.992_993insTCTG non_coding_transcript_exon_variant 0.29
rrs 1472841 n.996_1003delGGACGCGTinsACC non_coding_transcript_exon_variant 0.31
rrs 1472861 n.1016G>T non_coding_transcript_exon_variant 0.29
rrs 1472869 n.1024_1025delGTinsCGG non_coding_transcript_exon_variant 0.31
rrs 1472873 n.1028C>A non_coding_transcript_exon_variant 0.32
rrs 1472875 n.1030T>A non_coding_transcript_exon_variant 0.32
rrs 1472877 n.1032T>A non_coding_transcript_exon_variant 0.3
rrs 1472880 n.1035_1036insA non_coding_transcript_exon_variant 0.29
rrs 1472895 n.1050C>T non_coding_transcript_exon_variant 0.31
rrs 1473035 n.1190G>A non_coding_transcript_exon_variant 0.16
rrs 1473053 n.1208T>A non_coding_transcript_exon_variant 0.14
rrs 1473056 n.1211A>T non_coding_transcript_exon_variant 0.15
rrs 1473062 n.1217T>A non_coding_transcript_exon_variant 0.14
rrs 1473068 n.1223A>G non_coding_transcript_exon_variant 0.15
rrs 1473080 n.1235C>A non_coding_transcript_exon_variant 0.15
rrs 1473082 n.1237G>A non_coding_transcript_exon_variant 0.17
rrs 1473084 n.1239T>A non_coding_transcript_exon_variant 0.15
rrs 1473099 n.1254T>G non_coding_transcript_exon_variant 0.16
rrs 1473100 n.1255G>A non_coding_transcript_exon_variant 0.16
rrs 1473105 n.1260G>A non_coding_transcript_exon_variant 0.16
rrs 1473111 n.1266A>T non_coding_transcript_exon_variant 0.16
rrs 1473115 n.1270G>C non_coding_transcript_exon_variant 0.16
rrs 1473121 n.1276T>C non_coding_transcript_exon_variant 0.16
rrs 1473122 n.1277T>A non_coding_transcript_exon_variant 0.16
rrs 1473123 n.1278A>T non_coding_transcript_exon_variant 0.16
rrs 1473127 n.1282G>T non_coding_transcript_exon_variant 0.16
rrs 1473129 n.1284C>T non_coding_transcript_exon_variant 0.17
rrs 1473131 n.1286G>T non_coding_transcript_exon_variant 0.16
rrs 1473147 n.1302G>C non_coding_transcript_exon_variant 0.17
rrs 1473148 n.1303G>A non_coding_transcript_exon_variant 0.17
rrs 1473163 n.1318C>T non_coding_transcript_exon_variant 0.18
rrs 1473164 n.1319C>G non_coding_transcript_exon_variant 0.18
rrs 1473172 n.1327T>C non_coding_transcript_exon_variant 0.19
rrs 1473173 n.1328C>T non_coding_transcript_exon_variant 0.2
rrs 1473177 n.1332G>A non_coding_transcript_exon_variant 0.21
rrs 1473192 n.1347A>G non_coding_transcript_exon_variant 0.19
rrs 1473201 n.1356_1357delACinsT non_coding_transcript_exon_variant 0.15
rrs 1473205 n.1360T>C non_coding_transcript_exon_variant 0.14
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
thyX 3067248 p.Thr233Ile missense_variant 1.0
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
alr 3840719 c.702A>G synonymous_variant 1.0
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
ethA 4328245 c.-772C>T upstream_gene_variant 0.97
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0