TB-Profiler result

Run: ERR2516810

Summary

Run ID: ERR2516810

Sample name:

Date: 2024-03-27T03:13:12.118943

Number of reads: 3857720

Percentage reads mapped: 99.74

Median coverage: 132.0

Strain: lineage4.8

Spoligotype:

Drug-resistance: MDR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4 Euro-American None 1.0
lineage4.8 Euro-American (mainly T) RD219 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Ser450Leu Assoc w R
isoniazid katG p.Ser315Thr Assoc w R High-level resistance
ethambutol embB p.Met306Ile Assoc w R
pyrazinamide pncA p.Ser104Arg Assoc w R
streptomycin rpsL p.Lys43Arg Assoc w R
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide ethA c.356_420delACATCCAAAGCCACGGCACGCTCAGCGCCCTCACCTGCGAATTCCTCTTTCTGTGCAGCGGCTAC Assoc w R
clofazimine
para-aminosalicylic_acid
delamanid
bedaquiline
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin Assoc w R
rpsL 781687 p.Lys43Arg missense_variant 1.0 streptomycin Assoc w R
katG 2155168 p.Ser315Thr missense_variant 1.0 isoniazid Assoc w R High-level resistance
pncA 2288932 p.Ser104Arg missense_variant 1.0 pyrazinamide Assoc w R
embB 4247431 p.Met306Ile missense_variant 0.99 ethambutol Assoc w R
ethA 4327053 c.356_420delACATCCAAAGCCACGGCACGCTCAGCGCCCTCACCTGCGAATTCCTCTTTCTGTGCAGCGGCTAC frameshift_variant 1.0 ethionamide Assoc w R
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
Rv0010c 13807 c.-249G>T upstream_gene_variant 1.0 isoniazid
ccsA 620472 c.582C>T synonymous_variant 0.99 capreomycin Not assoc w R - Interim
amikacin Not assoc w R - Interim
kanamycin Not assoc w R - Interim
Rv0565c 656265 c.1204_1205delAC frameshift_variant 0.99 ethionamide Uncertain significance
rpoB 761528 p.Asp574Glu missense_variant 1.0 rifampicin Uncertain significance
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
embR 1416441 c.907C>T synonymous_variant 1.0 ethambutol Not assoc w R - Interim
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
kanamycin
capreomycin
amikacin
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0 capreomycin Not assoc w R
linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
PPE35 2168149 p.Pro822Ser missense_variant 1.0 pyrazinamide Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv2680 2995848 c.-257G>A upstream_gene_variant 0.99 capreomycin
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0 ethionamide Uncertain significance
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
ethA 4327053 c.355_420delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT conservative_inframe_deletion 1.0 ethionamide
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R