TB-Profiler result

Run: ERR3132203

Summary

Run ID: ERR3132203

Sample name:

Date: 01-04-2023 00:29:26

Number of reads: 1716808

Percentage reads mapped: 99.62

Strain: lineage4.1.2.1

Drug-resistance: RR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.2 Euro-American T;H None 1.0
lineage4.1.2.1 Euro-American (Haarlem) T1;H1 RD182 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
rpoB 761155 p.Ser450Leu missense_variant 1.0 rifampicin
embB 4247429 p.Met306Val missense_variant 1.0 ethambutol
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 5237 c.-3A>G upstream_gene_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491591 p.Lys270Met missense_variant 1.0
mshA 575679 p.Asn111Ser missense_variant 1.0
rpoB 760115 c.309C>T synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 776038 p.Ser815Ala missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.35
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
kasA 2518076 c.-39C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embC 4239789 c.-74G>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
whiB6 4338676 c.-155T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0