TB-Profiler result

Run: ERR3561980
Summary

Run ID: ERR3561980

Sample name:

Date: 01-04-2023 02:36:44

Number of reads: 1110933

Percentage reads mapped: 99.76

Strain: lineage4.8

Drug-resistance: HR-TB

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
fabG1 1673425 c.-15C>T upstream_gene_variant 1.0 isoniazid, ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.19
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2168149 p.Pro822Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
Rv2752c 3065182 p.Ser337Leu missense_variant 1.0
whiB7 3568617 c.63C>T synonymous_variant 1.0
rpoA 3878578 c.-71C>A upstream_gene_variant 0.67
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244667 p.Val479Met missense_variant 1.0
embA 4244874 p.Pro548Ser missense_variant 1.0
embA 4245534 p.Ser768Gly missense_variant 1.0
embB 4247992 c.1479G>A synonymous_variant 1.0
ubiA 4269864 c.-31C>T upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0
Rv3083 3448508 c.6_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0