TB-Profiler result

Run: ERR551192

Summary

Run ID: ERR551192

Sample name:

Date: 02-08-2023 08:21:38

Number of reads: NA

Percentage reads mapped: NA

Strain: lineage4.1

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6507 p.Ala423Val missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
gyrA 9656 c.2355C>G synonymous_variant 1.0
rpoC 765150 p.Gly594Glu missense_variant 1.0
rpoC 765187 c.1818C>T synonymous_variant 1.0
rpoC 766012 c.2643C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
mmpL5 775973 p.Leu836Phe missense_variant 1.0
mmpL5 776411 c.2070T>C synonymous_variant 1.0
mmpR5 779279 p.Pro97Leu missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rpsL 781421 c.-139C>A upstream_gene_variant 1.0
fbiC 1304734 p.Gln602* stop_gained 0.14
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.5
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472015 n.170A>G non_coding_transcript_exon_variant 1.0
rpsA 1834763 p.Glu408Lys missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
katG 2155856 p.Thr86Ala missense_variant 0.1
katG 2156007 c.105C>T synonymous_variant 1.0
PPE35 2170748 c.-136C>T upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
panD 4044165 c.117G>C synonymous_variant 0.1
embA 4242469 c.-764C>T upstream_gene_variant 0.11
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408102 p.Gly34Ala missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0