TB-Profiler result

Run: ERR6865319

Summary

Run ID: ERR6865319

Sample name:

Date: 02-04-2023 02:49:19

Number of reads: 1788056

Percentage reads mapped: 99.45

Strain: lineage4.1.1

Drug-resistance: HR-TB


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.1 Euro-American T;X;H None 1.0
lineage4.1.1 Euro-American (X-type) X1;X2;X3 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
inhA 1674048 c.-154G>A upstream_gene_variant 1.0 isoniazid, ethionamide
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrB 6052 p.Ile271Met missense_variant 1.0
gyrB 7221 p.Ser661Thr missense_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
fgd1 491386 p.Leu202Ile missense_variant 0.15
rpoC 765150 p.Gly594Glu missense_variant 1.0
rpoC 766533 p.Leu1055Arg missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
embR 1416699 p.Leu217Val missense_variant 0.98
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
inhA 1674484 p.Ile95Leu missense_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
thyA 3074494 c.-80_-24delCGCTGGGTTTGTTTGGCGGCGAGTCGCTGCGGCGGCTTCGCCGCGCTTGCGATCGCC upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embC 4242803 p.Val981Leu missense_variant 1.0
embB 4249408 c.2895G>A synonymous_variant 1.0
whiB6 4338191 p.Val111Met missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4407790 p.Ala138Glu missense_variant 1.0