TB-Profiler result

Run: ERR9121434


Run ID: ERR9121434

Sample name:

Date: 2024-04-14T02:49:29.216814

Number of reads: 2441888

Percentage reads mapped: 99.81

Median coverage: 127.0

Strain: lineage4.3.4.2


Drug-resistance: Other

Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4.3 Euro-American (LAM) None 1.0
lineage4 Euro-American None 1.0
lineage4.3.4 Euro-American (LAM) RD174 1.0
lineage4.3.4.2 Euro-American (LAM) RD174 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
moxifloxacin gyrA p.Asp94Gly Assoc w R High-level resistance
levofloxacin gyrA p.Asp94Gly Assoc w R
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
gyrA 7582 p.Asp94Gly missense_variant 1.0 moxifloxacin Assoc w R High-level resistance
levofloxacin Assoc w R
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.27 pretomanid Assoc w R - Interim Confers DLM-PMD cross-resistance
delamanid Assoc w R - Interim Confers DLM-PMD cross-resistance
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 7585 p.Ser95Thr missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
gyrA 9304 p.Gly668Asp missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
rpoC 764995 c.1626C>G synonymous_variant 1.0 rifampicin Not assoc w R
mmpL5 775639 p.Ile948Val missense_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 streptomycin
tsnR 1854300 p.Leu232Pro missense_variant 1.0 linezolid Not assoc w R
tlyA 1917972 c.33A>G synonymous_variant 1.0 capreomycin Not assoc w R
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 clofazimine Not assoc w R
bedaquiline Not assoc w R - Interim
Rv2752c 3065293 p.Val300Ala missense_variant 1.0 ethambutol Not assoc w R
moxifloxacin Uncertain significance
levofloxacin Uncertain significance
rifampicin Not assoc w R
isoniazid Not assoc w R - Interim
thyA 3073868 p.Thr202Ala missense_variant 1.0 para-aminosalicylic_acid
ald 3086788 c.-32T>C upstream_gene_variant 1.0 cycloserine
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0 pyrazinamide Not assoc w R
mtrB 3625065 p.Met517Leu missense_variant 1.0 bedaquiline Uncertain significance
rifampicin Not assoc w R
clpC1 4038287 c.2418C>T synonymous_variant 1.0 pyrazinamide Not assoc w R
embC 4239763 c.-100C>T upstream_gene_variant 1.0 ethambutol Not assoc w R
embC 4242643 c.2781C>T synonymous_variant 1.0 ethambutol Not assoc w R
embA 4245637 p.Pro802Leu missense_variant 0.99 ethambutol Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 capreomycin Not assoc w R
amikacin Not assoc w R
kanamycin Not assoc w R
whiB6 4338732 c.-211C>T upstream_gene_variant 1.0 capreomycin
gid 4408156 p.Leu16Arg missense_variant 1.0 streptomycin Not assoc w R