TB-Profiler result

Run: ERR9786372
Summary

Run ID: ERR9786372

Sample name:

Date: 02-04-2023 12:22:05

Number of reads: 667266

Percentage reads mapped: 95.41

Strain: lineage4.3.4.2

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.3 Euro-American (LAM) mainly-LAM None 1.0
lineage4.3.4 Euro-American (LAM) LAM RD174 1.0
lineage4.3.4.2 Euro-American (LAM) LAM1;LAM4;LAM11 RD174 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 6817 c.-485G>A upstream_gene_variant 1.0
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
rpoC 764995 c.1626C>G synonymous_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
fbiC 1305494 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT frameshift_variant&stop_lost&splice_region_variant 0.5
embR 1417258 c.90G>A synonymous_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrs 1472895 n.1050C>T non_coding_transcript_exon_variant 0.1
rrs 1472953 n.1108G>A non_coding_transcript_exon_variant 0.11
rrl 1476337 n.2680C>T non_coding_transcript_exon_variant 0.11
rrl 1476358 n.2701T>C non_coding_transcript_exon_variant 0.11
rrl 1476372 n.2715T>C non_coding_transcript_exon_variant 0.11
rrl 1476425 n.2768G>A non_coding_transcript_exon_variant 0.16
rrl 1476428 n.2771C>T non_coding_transcript_exon_variant 0.15
rrl 1476481 n.2824T>C non_coding_transcript_exon_variant 0.11
rrl 1476506 n.2849T>C non_coding_transcript_exon_variant 0.11
rrl 1476514 n.2857C>T non_coding_transcript_exon_variant 0.12
rrl 1476519 n.2862C>G non_coding_transcript_exon_variant 0.12
rrl 1476524 n.2867C>A non_coding_transcript_exon_variant 0.12
rrl 1476525 n.2868A>G non_coding_transcript_exon_variant 0.12
rrl 1476530 n.2873C>T non_coding_transcript_exon_variant 0.11
rrl 1476536 n.2879G>A non_coding_transcript_exon_variant 0.11
rrl 1476537 n.2880A>G non_coding_transcript_exon_variant 0.11
rrl 1476538 n.2881A>G non_coding_transcript_exon_variant 0.11
rrl 1476540 n.2883C>G non_coding_transcript_exon_variant 0.11
rrl 1476547 n.2890C>T non_coding_transcript_exon_variant 0.12
rrl 1476567 n.2910C>T non_coding_transcript_exon_variant 0.1
rrl 1476572 n.2915G>T non_coding_transcript_exon_variant 0.1
rrl 1476573 n.2916A>G non_coding_transcript_exon_variant 0.1
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2167866 p.Leu916Arg missense_variant 0.12
PPE35 2167967 c.2646A>G synonymous_variant 0.18
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
folC 2747766 c.-168A>G upstream_gene_variant 0.11
thyA 3073868 p.Thr202Ala missense_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
Rv3236c 3612009 p.Ala370Thr missense_variant 1.0
Rv3236c 3612682 p.Asn145Lys missense_variant 0.11
clpC1 4038287 c.2418C>T synonymous_variant 1.0
embC 4239763 c.-100C>T upstream_gene_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4244668 p.Val479Ala missense_variant 0.11
embB 4246532 c.25_79delAAAAGCACCCCAAATCGGGCGATTTTGGGGGCTTTTGCGTCTGCTCGCGGGACGC frameshift_variant 0.1
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
gid 4408156 p.Leu16Arg missense_variant 1.0
fbiC 1305494 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN frameshift_variant&stop_lost&splice_region_variant 1.0